View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7461_high_22 (Length: 255)
Name: NF7461_high_22
Description: NF7461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7461_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 11909036 - 11909281
Alignment:
| Q |
1 |
catgtgtgtgaacactacaaatgcctaactccttagtaattttctgatttacggtgatgcatataagaaacggtaggaggtagaaatgatcaggcaattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11909036 |
catgtgtgtgaacactacaaatgcctaactccttagtaattttctgatttatggtgatgcatataagaaacggtaggaggcagaaatgatcaggcaattg |
11909135 |
T |
|
| Q |
101 |
ctgaagccttggcagcgatggcatccaaatcagcagggaagtaacgatgagttccgagcactgggaagatttcaaggggaggtacgatcctcgaggtgct |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11909136 |
ctgaagccttgccagcgatggcatccaaatcagcagggaagtaacgacgagttccgagcaccgtgaagatttcaaggggaggtacgatcctcgaggtgct |
11909235 |
T |
|
| Q |
201 |
cagatttggatccaagcgattgagaagatttacataatgatgatgt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11909236 |
cagatttggatccaagcgattgagaagatttacataatgatgatgt |
11909281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 201 - 246
Target Start/End: Complemental strand, 11918597 - 11918552
Alignment:
| Q |
201 |
cagatttggatccaagcgattgagaagatttacataatgatgatgt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11918597 |
cagatttggatccaagcgattgagaagatttacataatgatgatgt |
11918552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 120
Target Start/End: Original strand, 11777347 - 11777447
Alignment:
| Q |
19 |
aaatgcctaactccttagtaattttctgatttacggtgatgcatataagaaacggtaggaggtagaaatgatcaggcaattgctgaagccttggcagcga |
118 |
Q |
| |
|
||||||||||||| | | ||||| ||||||| ||||||||| |||||||| ||| ||||||||||||||||||||||| | |||||||| | ||||| |
|
|
| T |
11777347 |
aaatgcctaactcttaaataattgtctgattct-ggtgatgcagataagaaaaggttagaggtagaaatgatcaggcaattaccgaagcctttgtagcga |
11777445 |
T |
|
| Q |
119 |
tg |
120 |
Q |
| |
|
|| |
|
|
| T |
11777446 |
tg |
11777447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University