View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7461_high_25 (Length: 243)

Name: NF7461_high_25
Description: NF7461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7461_high_25
NF7461_high_25
[»] chr8 (1 HSPs)
chr8 (20-243)||(42209833-42210056)


Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 20 - 243
Target Start/End: Original strand, 42209833 - 42210056
Alignment:
20 atccgtcatgacttgcctttggtagatgtagtgctaatatcagggggtttcatagtctctgttgattccctatccataatattttgatatgatctactgg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42209833 atccgtcatgacttgcctttggtagatgtagtgctaatatcagggggtttcatagtctctgttgattccctatccataatattttgatatgatctactgg 42209932  T
120 gagaccggctacctatagaaatccaacatagtcacgaaattatgacctaaagagagctcgatatctaactaggttatgtgtctaacctgcgacataacat 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42209933 gagaccggctacctatagaaatccaacatagtcacgaaattatgacctaaagagagctcgatatctaactaggttatgtgtctaacctgcgacataacat 42210032  T
220 tcatgaggcttagggtcttgtaaa 243  Q
    ||||||||||||||||||||||||    
42210033 tcatgaggcttagggtcttgtaaa 42210056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University