View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7461_high_26 (Length: 241)
Name: NF7461_high_26
Description: NF7461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7461_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 6685113 - 6685337
Alignment:
| Q |
1 |
tttaggattcttgattctaaatgttgttggggttgtttcaatttgttcagattgtgaaagagatgcataaagtttcaatttttgattggtatacttaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6685113 |
tttaggattcttgattctaaatgttgttggggttgtttcaatttgttcagattgtgaaagagatgcataaagtttcaatttttgtttggtatacttaatg |
6685212 |
T |
 |
| Q |
101 |
ggtctgtgtgattttaccttgaataggttgatgaagtgagaa---gggtgtgaagagaaattgaatgagaggcttttgagtttgggtgaggggtgtgtga |
197 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| ||| | ||||| ||||||||||||||| |
|
|
| T |
6685213 |
ggtctgtttgattttaccttgaataggttgatgaagtgagaaggggggtgtgaagagaaattgaaggagagggtttggtgtttgagtgaggggtgtgtga |
6685312 |
T |
 |
| Q |
198 |
tgaaagtggaagaagaataacagag |
222 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6685313 |
tgaaagtggaagaagaataacagag |
6685337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University