View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7461_high_31 (Length: 226)

Name: NF7461_high_31
Description: NF7461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7461_high_31
NF7461_high_31
[»] chr8 (1 HSPs)
chr8 (1-88)||(11917504-11917591)
[»] chr3 (1 HSPs)
chr3 (1-37)||(31855404-31855440)


Alignment Details
Target: chr8 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 11917591 - 11917504
Alignment:
1 ctaatattaacgaacttgcaactacatttaacaaacttcactaatattaaataataaaaaaccgcaaataatttaaacattataaact 88  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11917591 ctaatattaatgaacttgcaactacatttaacaaacttcactaatattaaataataaaaaaccgcaaataatttaaacattataaact 11917504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 31855404 - 31855440
Alignment:
1 ctaatattaacgaacttgcaactacatttaacaaact 37  Q
    ||||||||||| |||||| ||||||||||||||||||    
31855404 ctaatattaactaacttgtaactacatttaacaaact 31855440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University