View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7461_high_9 (Length: 340)
Name: NF7461_high_9
Description: NF7461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7461_high_9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 10 - 340
Target Start/End: Complemental strand, 42210375 - 42210045
Alignment:
| Q |
10 |
acctgtggccttgattgagttccacactcatgccggcaggcatctctaattttacacattgagggaaaatatcaaaatataacttggcaatactatactt |
109 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42210375 |
acctctggccttgattgagttccatactcatgccggcaggcatctctaattttacatattgagggaaaatatcaaaatataacttggcaatactatactt |
42210276 |
T |
 |
| Q |
110 |
ttaccctctaacataagataaattacgagcttactaaagtaaaattggatcacaccgatcattctgcgacnnnnnnncacaggcatgtaatgcctctgat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42210275 |
ttaccctctaacataagataaattacgagcttactaaagtaaaattggatcacaccgatcattctgcgacaaaaaaacacaggcatgtaatgcctctgat |
42210176 |
T |
 |
| Q |
210 |
ataacatggggctcttcatcaacattgctgatctcaatatgtcaattcactatttgtttgttacttcatgaacattgactgatttctggtttttgtgcag |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42210175 |
ataacatggggctcttcatcaacattgctgatctcaatatgtcaattcactatttgtttgttacttcatgaacattgactgatttctggtttttgtgcag |
42210076 |
T |
 |
| Q |
310 |
ccaatcaaatattgtcctttttacaagaccc |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42210075 |
ccaatcaaatattgtcctttttacaagaccc |
42210045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University