View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7461_low_16 (Length: 326)
Name: NF7461_low_16
Description: NF7461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7461_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 186 - 315
Target Start/End: Complemental strand, 1042029 - 1041900
Alignment:
| Q |
186 |
cgacaatccaaccacataagatttttgcatttgatctctcaatgtttcacatctctcttctcaacataaccgcacatcaatctcatttaaatttgctttc |
285 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1042029 |
cgacaaaccaaccacataagatttttgcatttgatctctcaatgtttcacatctctcttctcaacataaccgcacatcaatctcatttaaatttgctttc |
1041930 |
T |
|
| Q |
286 |
agttttgatctattttgctatgttattcat |
315 |
Q |
| |
|
||||||||||||||||||||| |||||||| |
|
|
| T |
1041929 |
agttttgatctattttgctatcttattcat |
1041900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 19 - 136
Target Start/End: Complemental strand, 1042196 - 1042079
Alignment:
| Q |
19 |
gattaatcattcaaagataacctttctcatttctactacatgttctattttataacctgttaatccatcgatgccatatttcataacttggtatcacggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1042196 |
gattaatcattcaaagataacctttctcatttctactacatgttctattttataacctgttaatccatcgatgccatatttcataacttggtatcacggt |
1042097 |
T |
|
| Q |
119 |
catgacacccatcttgtg |
136 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1042096 |
catgacacccatcttgtg |
1042079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University