View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7461_low_22 (Length: 291)
Name: NF7461_low_22
Description: NF7461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7461_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 20 - 286
Target Start/End: Complemental strand, 385050 - 384784
Alignment:
| Q |
20 |
acatctgcttaaagaatatatatatttccttccaattgctcatagggagggagagagatggatgtagagcatcacagcagcggcgaaggtccagcaacga |
119 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
385050 |
acatcagcttaaagaatatatatatttccttccaattgctcatagggagggagagagatggatgtagagcatcacagcagcggcgaaggtccagcaacga |
384951 |
T |
|
| Q |
120 |
acgatggatgttcaatctgtcacgaaaacttccaactcccatgtcaagcaaattgttctcactggttttgtgcaaactgtattatccaagtttggcaata |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
384950 |
acgatcgatgttcaatctgtcacgaaaacttccaactcccatgtcaagcaaattgttctcactggttttgtgcaaactgtattatccaagtttggcaata |
384851 |
T |
|
| Q |
220 |
ttattctcctcttcagccttgcaaatgtcctctttgtcgtcatcctattaatcttcttcttctcact |
286 |
Q |
| |
|
|| |||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
384850 |
ttcttctcctcttcaaccttgcaaatgtcctctttgtcgtcgtcctattaatcttcttcttcccact |
384784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 98 - 277
Target Start/End: Complemental strand, 390352 - 390173
Alignment:
| Q |
98 |
agcggcgaaggtccagcaacgaacgatggatgttcaatctgtcacgaaaacttccaactcccatgtcaagcaaattgttctcactggttttgtgcaaact |
197 |
Q |
| |
|
||||| ||||||||| |||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
390352 |
agcggagaaggtccaccaacaaacgatctatgttcaatctgtcacggaaacttccaactcccatgtcaagcaaattgttctcactggttttgcgctaact |
390253 |
T |
|
| Q |
198 |
gtattatccaagtttggcaatattattctcctcttcagccttgcaaatgtcctctttgtcgtcatcctattaatcttctt |
277 |
Q |
| |
|
| || |||||||||||||| |||| |||||||||||| ||||||||||||||||| ||||||| ||||||||| |||||| |
|
|
| T |
390252 |
gcataatccaagtttggcagtattcttctcctcttcaaccttgcaaatgtcctctctgtcgtcgtcctattaaccttctt |
390173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University