View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7461_low_26 (Length: 276)
Name: NF7461_low_26
Description: NF7461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7461_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 126 - 265
Target Start/End: Original strand, 3942258 - 3942397
Alignment:
| Q |
126 |
attgtacaaaaaagaagaagctggtattgtcattacaatagatagataaacatttatgatagttattaatataataagtaataaagctaatattttcact |
225 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
3942258 |
attgtacaaaaaagaagaagctgatattgtcattacaatagatagataaacatttatgatagttattaataaaataagaaataaagctaatattttcact |
3942357 |
T |
 |
| Q |
226 |
catataccaaactttataatttatttacatattgaatatt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3942358 |
catataccaaactttataatttatttacatattgaatatt |
3942397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 3942133 - 3942202
Alignment:
| Q |
1 |
atgagacctatttctattgcagttccttcaactggaattagcctatccctgctggctgatgcgagtagaa |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| ||||||| |
|
|
| T |
3942133 |
atgagacctatttctattgcagttccttcaactggaattagcctacccctgctggccgatgcaagtagaa |
3942202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University