View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7461_low_31 (Length: 243)
Name: NF7461_low_31
Description: NF7461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7461_low_31 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 20 - 243
Target Start/End: Original strand, 42209833 - 42210056
Alignment:
| Q |
20 |
atccgtcatgacttgcctttggtagatgtagtgctaatatcagggggtttcatagtctctgttgattccctatccataatattttgatatgatctactgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42209833 |
atccgtcatgacttgcctttggtagatgtagtgctaatatcagggggtttcatagtctctgttgattccctatccataatattttgatatgatctactgg |
42209932 |
T |
|
| Q |
120 |
gagaccggctacctatagaaatccaacatagtcacgaaattatgacctaaagagagctcgatatctaactaggttatgtgtctaacctgcgacataacat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42209933 |
gagaccggctacctatagaaatccaacatagtcacgaaattatgacctaaagagagctcgatatctaactaggttatgtgtctaacctgcgacataacat |
42210032 |
T |
|
| Q |
220 |
tcatgaggcttagggtcttgtaaa |
243 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42210033 |
tcatgaggcttagggtcttgtaaa |
42210056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University