View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7461_low_37 (Length: 226)
Name: NF7461_low_37
Description: NF7461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7461_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 11917591 - 11917504
Alignment:
| Q |
1 |
ctaatattaacgaacttgcaactacatttaacaaacttcactaatattaaataataaaaaaccgcaaataatttaaacattataaact |
88 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11917591 |
ctaatattaatgaacttgcaactacatttaacaaacttcactaatattaaataataaaaaaccgcaaataatttaaacattataaact |
11917504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 31855404 - 31855440
Alignment:
| Q |
1 |
ctaatattaacgaacttgcaactacatttaacaaact |
37 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
31855404 |
ctaatattaactaacttgtaactacatttaacaaact |
31855440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University