View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7461_low_38 (Length: 222)
Name: NF7461_low_38
Description: NF7461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7461_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 33678106 - 33678293
Alignment:
| Q |
18 |
tcaacagcttgtttttatgaacgtatgtgttaccatttggttttctagaagatggagtgctgggaaatattcaaaactactcatggaggacaagcgatgg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33678106 |
tcaacagcttgtttttatgaacgtatgtgttaccatttggttttctagaagatggggtgctgggaaatattcaaaactactcatggaggacaagcgatgg |
33678205 |
T |
|
| Q |
118 |
cagtccatggtaatttcagtggattaattggtaggctgaatggacttgggaaatttattctgatccttgaaattagggtgtctatatc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33678206 |
cagtccatggtaatttcagtggattaattggtaggctgaatggacttggggaatttattctgatccttgaaattagggtgtctatatc |
33678293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University