View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7462_low_10 (Length: 240)
Name: NF7462_low_10
Description: NF7462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7462_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 15527161 - 15527377
Alignment:
| Q |
1 |
ttggtggtgtacgtagtggtgtttgtatcataacttttcaaactgcttctatcattatcaccctctaagtatttcttgtgctttataatgtgtttttaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15527161 |
ttggtggtgtacgtagtggtgtttgtatcataacttttcaaactgcttctatcattatcaccctcaaagtatttcttgtgctttataatgtgtttttaaa |
15527260 |
T |
 |
| Q |
101 |
acaaaattctttttgcttattaaaataaataatgaaaaaagtgatactatatttatactactttcttctc--ttaaccatgacaaccaggagaatcaaac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||| ||| ||||||| |
|
|
| T |
15527261 |
acaaaattctttttgcttattaaaataaataatgaaaaaagtgatac--tatttatactactttcttttcatataaccatgacaacaagg---atcaaac |
15527355 |
T |
 |
| Q |
199 |
acttcattttctactatttata |
220 |
Q |
| |
|
| ||| |||||||||||||||| |
|
|
| T |
15527356 |
atttcgttttctactatttata |
15527377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University