View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7462_low_12 (Length: 225)
Name: NF7462_low_12
Description: NF7462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7462_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 10500407 - 10500607
Alignment:
| Q |
1 |
agccaaatcaaattcatcctattttcaagttagtgcatatttggaatattgcggtacatttacaaaattatagtgacactgtgattttgttgaagtttta |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||| || ||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
10500407 |
agccaaatcaaattcatc-tattttcaagttagggcatatttaga---ttgcggtacatttacaaaattgtagtgacactgtaattttgttgaagtttta |
10500502 |
T |
|
| Q |
101 |
gattttagttattgtcaaaattacgtcgactcgctataacataatgtatttatgttattaatttaaatcttggttaacatgtaggatttgaacttccact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
10500503 |
gattttagttattgtcaaaattacgtcgactcgctataacataatgtatttatgttattaatttaaatcttgattaacatgtagggtttgaacttccact |
10500602 |
T |
|
| Q |
201 |
agtgg |
205 |
Q |
| |
|
|||| |
|
|
| T |
10500603 |
ggtgg |
10500607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 64 - 101
Target Start/End: Complemental strand, 24578564 - 24578527
Alignment:
| Q |
64 |
aaaattatagtgacactgtgattttgttgaagttttag |
101 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
24578564 |
aaaattacagtgatactgtgattttgttgaagttttag |
24578527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University