View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7462_low_15 (Length: 209)
Name: NF7462_low_15
Description: NF7462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7462_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 13 - 193
Target Start/End: Complemental strand, 28198476 - 28198296
Alignment:
| Q |
13 |
gagaagaagtttgaggttgagagagtggtgcgcattggatgagtttggcaacgaaaatggcgtcttggagtgtgtagagaccggaggtgatgatcgtgga |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28198476 |
gagatgaagtttgaggttgagagagtggtgcgcattggatgagtttggcgacgaaaatggcgtcttggagtgtgtagagaccggaggtgatgatcgtgga |
28198377 |
T |
|
| Q |
113 |
ttgaatttgattccattgtttcaggttttggtgattctttgaaagggatgcaattgcattgcgcagagaaactaaaacttg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28198376 |
ttgaatttgattccattgtttcaggttttgatggttctttgaaagggatgcaattgcattgcgcagataaactaaaacttg |
28198296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 13 - 172
Target Start/End: Complemental strand, 2377545 - 2377381
Alignment:
| Q |
13 |
gagaagaagtttgaggttgagagagtggtgcgcattggatgagtttggcaacgaaaa-tggcgtcttggagtgtgtagaga----ccggaggtgatgatc |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||| | |||| ||| | || ||||| | | ||| ||||| || |
|
|
| T |
2377545 |
gagatgaagtttgaggttgagagagtggtgggcattggatgagtttggtgacgaaaaatagcgtgttgaaatgagtagatagatactggaagtgattatg |
2377446 |
T |
|
| Q |
108 |
gtggattgaatttgattccattgtttcaggttttggtgattctttgaaagggatgcaattgcatt |
172 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2377445 |
atggattgaatttgattccattgttttaggttttggtggttctttgaaagggatgcaattgcatt |
2377381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University