View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7463_high_10 (Length: 333)
Name: NF7463_high_10
Description: NF7463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7463_high_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 10 - 317
Target Start/End: Original strand, 32997410 - 32997717
Alignment:
| Q |
10 |
ggtggtcatgtccattgttgagaggaattgtcccggatcaaaatattccacagtaatgcacttatagatcgactcaccaaggctttctctaccattctga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32997410 |
ggtggtcatgtccattgttgagaggaattgtcccggatcaaagtattccacagtaatgcacttatagattgactcaccaaggctttctctaccattctga |
32997509 |
T |
|
| Q |
110 |
caaagacatgaaagaaaataaaaacttagttacataaagatttcagcattatctctataccataccgtgagatcataaagcgnnnnnnnaaaagctctct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
32997510 |
caaagacatgaaagaaaataaaaacttagttacataaagatttcagcattatctctataccataccgtgagatcataaagcgtttttttataagctctct |
32997609 |
T |
|
| Q |
210 |
caaacggtctcacaagtgcttatattacaagcgcaaataaatcaatctaaaccgacccttaattatattaccttagggagagattcgatgtagttgtcag |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32997610 |
caaacggtctcacaagtgcttatattacaagcgcaaataaatcaatctaaaccgacccttaattatattaccttagggagagattcgatgtagttgtcag |
32997709 |
T |
|
| Q |
310 |
gtatctcc |
317 |
Q |
| |
|
|||||||| |
|
|
| T |
32997710 |
gtatctcc |
32997717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 201 - 236
Target Start/End: Original strand, 4071963 - 4071998
Alignment:
| Q |
201 |
aagctctctcaaacggtctcacaagtgcttatatta |
236 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4071963 |
aagctctctcaaacagtctcacaagtgcttatatta |
4071998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 199 - 232
Target Start/End: Original strand, 3024713 - 3024746
Alignment:
| Q |
199 |
aaaagctctctcaaacggtctcacaagtgcttat |
232 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
3024713 |
aaaagctctctcaaacagtctcacaagtgcttat |
3024746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University