View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7463_high_14 (Length: 281)
Name: NF7463_high_14
Description: NF7463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7463_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 82 - 140
Target Start/End: Complemental strand, 14923470 - 14923412
Alignment:
| Q |
82 |
acaatgaagaagtgttcttgggaatatatcttagatatagggtttgattatattataat |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14923470 |
acaatgaagaagtgttcttgggaatatatcttagatatagggtttcattatattataat |
14923412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 16 - 140
Target Start/End: Complemental strand, 14915047 - 14914926
Alignment:
| Q |
16 |
atacaagggatcacatggattgaatatgcatgtggatttgtacnnnnnnnnn----gaaaaatagtgattacaatgaagaagtgttcttgggaatatatc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |||||||||||||||| ||||||||||| |
|
|
| T |
14915047 |
atacaagggatcacatggattgaatatgcatgtggatttgtacttttttttttgttgaaaaa----gatgacaatgaagaagtgtt---gggaatatatc |
14914955 |
T |
|
| Q |
112 |
ttagatatagggtttgattatattataat |
140 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14914954 |
ttagatatagggtttgattatattataat |
14914926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 184 - 246
Target Start/End: Complemental strand, 14923364 - 14923306
Alignment:
| Q |
184 |
tccttattaagtatgaaaataaagaggaaagtggagattggtgaacccctcctttgattgtct |
246 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14923364 |
tccttattaagtatgaaaa----gaggaaagtggagattggtgaacccctcctttgattgtct |
14923306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 16 - 58
Target Start/End: Complemental strand, 14923538 - 14923496
Alignment:
| Q |
16 |
atacaagggatcacatggattgaatatgcatgtggatttgtac |
58 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14923538 |
atacaagggatcatatggattgaatatgcatgtggatttgtac |
14923496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University