View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7463_low_1 (Length: 873)
Name: NF7463_low_1
Description: NF7463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7463_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 2e-76
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 45393733 - 45393560
Alignment:
| Q |
1 |
cagcgggttgagaagaagtgaaggaagaagaacaaagattaagcattggtttggaaacggagataaatgaccaattgcatgttctgatgaattttgggtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45393733 |
cagcgggttgagaagaagtgaaggaagaagagcaaagattaagcattggtttggaaacggagataaatgaccaattgcatgttttgatgaattttgggtt |
45393634 |
T |
|
| Q |
101 |
agttgtgcggtgaagattgatcagaaatggagaagggagtgtgcgcatgaatgtgaattgattatgcataatat |
174 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||| ||| |||| |
|
|
| T |
45393633 |
agttgtgcggtgaagatggatgagaaatggagaagggagtgtacgcatgaatgtgaattgattatccatcatat |
45393560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 8 - 174
Target Start/End: Complemental strand, 45381375 - 45381209
Alignment:
| Q |
8 |
ttgagaagaagtgaaggaagaagaacaaagattaagcattggtttggaaacggagataaatgaccaattgcatgttctgatgaattttgggttagttgtg |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||| |||| ||||||||||||| || |||| ||||| ||||||||||||||| |
|
|
| T |
45381375 |
ttgagaagaagtgaaggaagaagagtaaagattaaacattggtttggaaattgagacaaatgaccaattgaatcttcttatgaagtttgggttagttgtg |
45381276 |
T |
|
| Q |
108 |
cggtgaagattgatcagaaatggagaagggagtgtgcgcatgaatgtgaattgattatgcataatat |
174 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
45381275 |
cggtgaagatggatgagaaatggagaagggagtgtacgcatgaatgtgaattgattatccataatat |
45381209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University