View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7463_low_15 (Length: 291)

Name: NF7463_low_15
Description: NF7463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7463_low_15
NF7463_low_15
[»] chr2 (2 HSPs)
chr2 (5-276)||(31650480-31650751)
chr2 (207-276)||(31657494-31657563)


Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 5 - 276
Target Start/End: Complemental strand, 31650751 - 31650480
Alignment:
5 gctagattattctacataagaattaattatcttccaatgccaaatcgaaaataaacttgcctatcaatatatatccacatgcctattctcttggtgtagt 104  Q
    ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31650751 gctagattattttacataagaattaattatcctccaatgccaaatcgaaaataaacttgcctatcaatatatatccacatgcctattctcttggtgtagt 31650652  T
105 gtgtttctcttaatgtcttagatttgaatcctcccagtggcaatttaccagattaatcactcattagacggataacgagttttatgaagataaataaaat 204  Q
    ||| ||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||    
31650651 gtgcttctcttaatgtcttagatttgaatcctcccggtggcaatttaccaaattaatcactcattagacggataacgagttttatgaagaaaaataaaat 31650552  T
205 tttcaaattaaaaagattcactcgatgatgactcactgacatgtctcaaataatcaaaataaacatcaaaat 276  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31650551 tctcaaattaaaaagattcactcgatgatgactcactgacatgtctcaaataatcaaaataaacatcaaaat 31650480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 207 - 276
Target Start/End: Complemental strand, 31657563 - 31657494
Alignment:
207 tcaaattaaaaagattcactcgatgatgactcactgacatgtctcaaataatcaaaataaacatcaaaat 276  Q
    |||||||||||||||||  |||||||| ||||||| |||| ||| |||||||| ||||| ||||||||||    
31657563 tcaaattaaaaagattcgatcgatgataactcactaacatctcttaaataatcgaaatacacatcaaaat 31657494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University