View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7463_low_28 (Length: 236)

Name: NF7463_low_28
Description: NF7463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7463_low_28
NF7463_low_28
[»] chr4 (1 HSPs)
chr4 (17-201)||(34069519-34069703)


Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 34069703 - 34069519
Alignment:
17 aagtttgtgcagaagcgcatgcatattgcacttgattttactgttgtattgtatttgaatacttttgttgtataatttataaaggttgaatttgtcgaaa 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34069703 aagtttgtgcagaagcgcatgcatattgcacttgattttactgttgtattgtatttgaatacttttgttgtataatttataaaggttgaatttgtcgaaa 34069604  T
117 agcaaccaagataaagatggtgagtctgaaatactcttctcatggaagccatactattaaaaattcttgaactggaaagtgaccc 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34069603 agcaaccaagataaagatggtgagtctgaaatactcttctcatggaagccatactattaaaaattcttgaactggaaagtgaccc 34069519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University