View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7464_low_1 (Length: 499)
Name: NF7464_low_1
Description: NF7464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7464_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 38072075 - 38072277
Alignment:
| Q |
20 |
atcaagagaagccaaaatgctacagcaattgattaacagaggtctagcattcttcatagctagaaagttaagtctccaagtcttgtatggaaaccattta |
119 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38072075 |
atcaagagaagccaaaatgctacagctattgattaacagaggtctagcattcttcattgctagaaatttaagtctccaagtcttgtatggaaaccattta |
38072174 |
T |
|
| Q |
120 |
aaacgtgtttgatctgttaaaaaatagaagattagattgaacaattttcttttatatcttgttttatttagaaactgatctttgagactgaacaaaatag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38072175 |
aaacgtgtttgatctgttaaaaaatagaagattagattgaacaatttttttttatatcttgttttatttagaaactgatctttgagactgaacaaaatag |
38072274 |
T |
|
| Q |
220 |
gta |
222 |
Q |
| |
|
||| |
|
|
| T |
38072275 |
gta |
38072277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 422 - 491
Target Start/End: Original strand, 38072481 - 38072550
Alignment:
| Q |
422 |
taactttgtcttttattttttatttccctcttatgtctctagtatctctcttatttctccatttcatctc |
491 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38072481 |
taactttgtcttttattttttatttccctcttatgtctctagtatctctcttatttctccatttcatctc |
38072550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 299 - 345
Target Start/End: Original strand, 38072358 - 38072404
Alignment:
| Q |
299 |
actttctctatctccccctctcactactctcgcatgacatctccctg |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38072358 |
actttctctatctccccctctcactactctcgcatgacatctccctg |
38072404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University