View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7464_low_14 (Length: 228)
Name: NF7464_low_14
Description: NF7464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7464_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 87 - 208
Target Start/End: Complemental strand, 32600048 - 32599927
Alignment:
| Q |
87 |
gtgttgacgtctctctttatttaccctacctggcaatgtgagactcaagatatctttatagacttcaaacaatctccatcttggctaaaatctatacata |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32600048 |
gtgttgacgtctctctttatttaccctacatggcaatgtgagactcaagatatctttataaacttcaaacaatctccatcttggctaaaatctatacata |
32599949 |
T |
|
| Q |
187 |
tttcttcaattttcattgcata |
208 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32599948 |
tttcttcaattttcattgcata |
32599927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 32600128 - 32600066
Alignment:
| Q |
1 |
agaaaataagaaagttagatatgagtttaaaatgtttcctattagtattttgtaacgaagaac |
63 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32600128 |
agaaaataagaaagttagatataagtttaaaatgtttcctattagtattttgtaatgaagaac |
32600066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University