View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7464_low_15 (Length: 215)
Name: NF7464_low_15
Description: NF7464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7464_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 10251987 - 10252169
Alignment:
| Q |
18 |
ttatgtacctcaaacaaaattgaaatcgggcaatatgtggttaagaaaattgatagaggcacctactcctttgagtggctaaaagaaaggtggacccttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10251987 |
ttatgtacctcaaacaaaattgaaatcgggcaatatgtggttcagaaaattgatagaggcacctactcctttgagtggctaaaagaaaggtggacccttt |
10252086 |
T |
 |
| Q |
118 |
gcgcattaatgaattccaaagagaaatatcatgatttagttttatgcttcattttcaccacacatatgcacccctctatgcta |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
10252087 |
gcgcattaatggattccaaagagaaatatcatgatttagttttatgcttcattttcaccacacagatgtacccctctatgcta |
10252169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University