View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7464_low_5 (Length: 335)
Name: NF7464_low_5
Description: NF7464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7464_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 18 - 311
Target Start/End: Complemental strand, 32729466 - 32729172
Alignment:
| Q |
18 |
actataagtagtaaacaatttttcgttctaacagttgaaatttcggaaagggaatctgnnnnnnnn-attaccaaaactgttcctcaaatacaaaccttg |
116 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
32729466 |
actataagtagtaaacaatttttcattctaacagttgaaatttcggaaagggaatctgtttttttttattaccacaactgttcctcaaatacaaaccttg |
32729367 |
T |
 |
| Q |
117 |
aacttccaaatggaattaccttggaaacgttgagcaatggcgtaagagcaaacattcccaaagtaatgacgtgtaatcaagagaatctcagccattgaga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32729366 |
aacttccaaatggaattaccttggaaacgttgagcaatggcgtaagagcaaacattcccaaagtaatgacgtgtaatcaagagaatctcagccattgaga |
32729267 |
T |
 |
| Q |
217 |
tggtgcctagtactatacggacggttacaatatagttaaaggcagtaggatatgcacgacaaactttattttaacattttcgtttgatatagaga |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32729266 |
tggtgcctagtactatacggacggttacaatatagttaaaggcagtaggatatgcacgacaaactttattttaacattttcgtttgatatagaga |
32729172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University