View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7464_low_9 (Length: 254)
Name: NF7464_low_9
Description: NF7464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7464_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 8 - 237
Target Start/End: Original strand, 12544280 - 12544490
Alignment:
| Q |
8 |
atattattctatactatacaatatatcttatacaatgccactgtcatattacagtatcatattaaaatttaacccaattccgccatacacattggcttct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||| |
|
|
| T |
12544280 |
atattattctatactatacaatatatcttatacaatgccactgtcatattacagtatcatattaaaatttagcc----tcc---------------ttct |
12544360 |
T |
 |
| Q |
108 |
taacacgatttatgttttcctgaatgttgatgattacatagaaaagtaatattaatagacagattagattagatacaaaaatacagatcttattaatatc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12544361 |
taacacgatttatgttttcctgaatgttgatgattacatagaaaagtaatattaatagacagattagattagatacaaaaatacagatcttattaatatc |
12544460 |
T |
 |
| Q |
208 |
gattcttaaattcctgcaaaacaatacgtg |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12544461 |
gattcttaaattcctgcaaaacaatacgtg |
12544490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University