View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7465_high_10 (Length: 265)
Name: NF7465_high_10
Description: NF7465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7465_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 256
Target Start/End: Complemental strand, 49054970 - 49054732
Alignment:
| Q |
18 |
cttctaccgcaactgaagcatttaagccctaaactacaacctgtcaattgatcgtcaagtaatcacacatcttccatcaaccatcaacaaacaatgcatc |
117 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49054970 |
cttctaccgcaaccgaagcatttaagccctaaactacaatctgtaaattgatcgtcaagtaatcacacatcttccatcaaccatcaacaaacaatgcatc |
49054871 |
T |
 |
| Q |
118 |
aaggaggtttgaagatgaattgctactctcagcctcttcaaagaaaccagtggcggcattccctcttctggctctacgctcttcgatgacgggatcatct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49054870 |
aaggaggtttgaagatgaattgctactctcagcttcttcaaagaaaccattggcggcattctctcttctggctctacgctcttcgatgacggaatcatct |
49054771 |
T |
 |
| Q |
218 |
gtttcagtgcagtaatttcgtcgaccatgttccacaggt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49054770 |
gtttcagtgcagtaatttcgtcgaccatgtttcacaggt |
49054732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University