View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7465_high_8 (Length: 280)
Name: NF7465_high_8
Description: NF7465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7465_high_8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 4 - 280
Target Start/End: Complemental strand, 25296005 - 25295722
Alignment:
| Q |
4 |
aatctgtttcttggtccatataaaaatttgttagtatgtttttcacattgaattaatttcatgaatagataatagggttttcgatttcatgaatatcttt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25296005 |
aatctgtttcttggtccatataaaaatttgttagtatgtttttcacattgaattaatttcatgaatagataatagggttttcgatttcatgaatatcttt |
25295906 |
T |
 |
| Q |
104 |
caatgttatgtttttgactttgtttggttgtattaaatgtgaaaagaatagatggattggtgtatttttgtagggatgttatcacgttgttattcttgag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25295905 |
caatgttatgtttttgactttgtttggttgtattaaatgtgaaaagaatagatggattggtgtatttttgtagggatgttatcaagttgttattcttgag |
25295806 |
T |
 |
| Q |
204 |
atttctgtatgatttaatgagcaatgattaaaa---tgttcactcatatgattaggat----tatgattaatgcttcttctcac |
280 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
25295805 |
atttctgtatgatttaattagcaatgattaaaatattgttcactcatatgattaggattatatatgattaatgcttcttttcac |
25295722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University