View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7465_low_12 (Length: 271)
Name: NF7465_low_12
Description: NF7465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7465_low_12 |
 |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 102 - 263
Target Start/End: Complemental strand, 36336642 - 36336481
Alignment:
| Q |
102 |
atttctggaaggatttcgtttcttcttcacggtttgagcttggatcatggggactcctgaattcccagatctaggcaagcattgttctgtttctgattgc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36336642 |
atttctggaaggatttcgtttcttcttcacggtttgagcttggatcatggggactcctgaattcccagatctaggcaagcattgttctgtttctgattgc |
36336543 |
T |
 |
| Q |
202 |
agactcatcgatttcttgcccttcacttgtgatcgttgcaatcaggttttgtttttcatctc |
263 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36336542 |
agactcatcgattttttgcccttcacttgtgatcgttgcaatcaggttttgtttttcatctc |
36336481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0100 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 148 - 248
Target Start/End: Original strand, 38933 - 39033
Alignment:
| Q |
148 |
atggggactcctgaattcccagatctaggcaagcattgttctgtttctgattgcagactcatcgatttcttgcccttcacttgtgatcgttgcaatcagg |
247 |
Q |
| |
|
||||| ||||| ||||| ||||||||||| || || || ||| || ||||||| ||| | |||||||||||||||||||| ||||| ||| |||||| |
|
|
| T |
38933 |
atgggtactccagaatttccagatctaggaaaacactgcgctgactccgattgcaagctcgttgatttcttgcccttcacttgcgatcgctgctatcagg |
39032 |
T |
 |
| Q |
248 |
t |
248 |
Q |
| |
|
| |
|
|
| T |
39033 |
t |
39033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University