View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7465_low_14 (Length: 261)
Name: NF7465_low_14
Description: NF7465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7465_low_14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 96 - 261
Target Start/End: Original strand, 1636703 - 1636868
Alignment:
| Q |
96 |
cctcaatccaaatatatgatcatatcatatatattttttccattaaaccgtcacgaatactaaaacaaactagactttgatgtaattgacaaatagtttc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1636703 |
cctcaatccaaatatatgatcatatcatatatattttttccattaaaccgtcacgaatactaaaacaaactagactttgatgtaattgacaaatagtttc |
1636802 |
T |
 |
| Q |
196 |
aataacaacaagccctagtttgtgctttttcttannnnnnnatttaaaggatccacctttctcttc |
261 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||| |||||||||||||||||| |||||| |
|
|
| T |
1636803 |
aataacaacaagccctagcttgtgcttttttttatttttttatttaaaggatccaccttcctcttc |
1636868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University