View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7466_high_2 (Length: 344)
Name: NF7466_high_2
Description: NF7466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7466_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 16 - 186
Target Start/End: Complemental strand, 35165949 - 35165779
Alignment:
| Q |
16 |
atcaccaaattagttaacatcatatctttcatgaatcaaattgacgttttcatgaacgtgcactcaccccatttccagaaactagtataaattaaaatta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
35165949 |
atcaccaaattagttaacatcatatctttcatgaatcaaattgacgttttcatgaacgtgcgctcaccctatttccataaactagtataaattaaaatta |
35165850 |
T |
 |
| Q |
116 |
tgggcataaaccacgttatgtgggtagattgcggcactggcacgtctccacttggaaggagaggaagagga |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35165849 |
tgggcataaaccacgttatgtgggtagattgcggcactggcacgtctccacttggaaggagaggaagagga |
35165779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 294 - 327
Target Start/End: Complemental strand, 35165781 - 35165748
Alignment:
| Q |
294 |
ggaacgtggttcacactacaactagatctaagct |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35165781 |
ggaacgtggttcacactacaactagatctaagct |
35165748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University