View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7466_high_3 (Length: 308)
Name: NF7466_high_3
Description: NF7466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7466_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 19 - 264
Target Start/End: Complemental strand, 32434341 - 32434096
Alignment:
| Q |
19 |
tcaagatatcgattccaacagggtttgaggctttgacgcgtagatactcatcgtcgccgagtacagctttgtacatggaaaggaaatcgatgacgggaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32434341 |
tcaagatatcgattccaacagggtttgaggctttgacgcgtagatactcatcgtcgccgagtacagctttgtacatggaagggaaatcgatgacgggaac |
32434242 |
T |
 |
| Q |
119 |
ggtgagtgtgccgtccatgtcgaaaacgacacctcggaggcgcgttttgggggttaagtgtgatgacatgatgcgagggaagaggaggaaagcttttgtg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32434241 |
ggtgagtgtgccgtccatgtcgaaaacgacgcctcggaggcgcgttttgggggttaagtgtgatgacatgatgcgagggaagaggaggaaagcttttgtg |
32434142 |
T |
 |
| Q |
219 |
gaagagagcaatggcatctagtgaagtagagtagaatagagagata |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32434141 |
gaagagagcaatggcatctagtgaagtagagtagaatagagagata |
32434096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University