View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7466_low_3 (Length: 344)

Name: NF7466_low_3
Description: NF7466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7466_low_3
NF7466_low_3
[»] chr8 (2 HSPs)
chr8 (16-186)||(35165779-35165949)
chr8 (294-327)||(35165748-35165781)


Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 16 - 186
Target Start/End: Complemental strand, 35165949 - 35165779
Alignment:
16 atcaccaaattagttaacatcatatctttcatgaatcaaattgacgttttcatgaacgtgcactcaccccatttccagaaactagtataaattaaaatta 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||||    
35165949 atcaccaaattagttaacatcatatctttcatgaatcaaattgacgttttcatgaacgtgcgctcaccctatttccataaactagtataaattaaaatta 35165850  T
116 tgggcataaaccacgttatgtgggtagattgcggcactggcacgtctccacttggaaggagaggaagagga 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35165849 tgggcataaaccacgttatgtgggtagattgcggcactggcacgtctccacttggaaggagaggaagagga 35165779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 294 - 327
Target Start/End: Complemental strand, 35165781 - 35165748
Alignment:
294 ggaacgtggttcacactacaactagatctaagct 327  Q
    ||||||||||||||||||||||||||||||||||    
35165781 ggaacgtggttcacactacaactagatctaagct 35165748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University