View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7467_high_1 (Length: 330)
Name: NF7467_high_1
Description: NF7467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7467_high_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 20 - 316
Target Start/End: Complemental strand, 23387205 - 23386907
Alignment:
| Q |
20 |
tggataagggaaatttatatagaagaagctttgtgtgatataagttaaagtattaatgttatgactttatcaacattgaagaaaatgtctggtcttgtgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||||||||||||| ||| |
|
|
| T |
23387205 |
tggataagggaaatttatatagaagaagctttgtgtgatataagtttaagtattaatgttatgattttatcaacattcaagaaaatgtctggtcttatgg |
23387106 |
T |
|
| Q |
120 |
agaagcatacctacatagttgttagcttagcagacatattttctgtgaaaccgcatggtaaagtcaaaggtggaatttcacaagtggatcgtcttaagtt |
219 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23387105 |
agaagcatacctacatagttgttggcttagcagacatattttctgtgaaaccgcatggtaaagttaaaggtggaatttcacaagtggatcgtcttaagtt |
23387006 |
T |
|
| Q |
220 |
tcaagtttatttcctcattttagagatagaagataaagaggagac--agctcttacttgggagaccttttctggcatctgttaaagccctaattgatgt |
316 |
Q |
| |
|
| ||||||||||||||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23387005 |
taaagtttatttcctcattttagagattgaagataaataggagacaaagctcttacttgggagaccttttctggcatctgttaaagccctaatcgatgt |
23386907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University