View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7467_high_5 (Length: 278)
Name: NF7467_high_5
Description: NF7467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7467_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 19 - 263
Target Start/End: Complemental strand, 29561899 - 29561656
Alignment:
| Q |
19 |
acaatggtcccaaatgcaggagatgctaggccaggtgagggaagagatggaagaactgcaggcttcacgagatttctggaaagatcgcgccttgcattct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29561899 |
acaatggtcccaaatgcaggagatgctaggccaggtgagggaagagatggaagaactgcaggcttcacgagatttctggaaagatcgcgccttgcattct |
29561800 |
T |
|
| Q |
119 |
gattctcaaatccaatctctacacaatgatgtaagataaagtttattcttacattcaacaacctcttaggaccgtgtttacttctagtcgtttatttctg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29561799 |
gattctcaaatccaatctctacacaatgatgtaagataaagtttattcttacattcaacaacctcttaggaccgtgtttacttctagtcgtttatttctg |
29561700 |
T |
|
| Q |
219 |
gcgcttcctgtttgcattaacttttgtattttctttcacacaggt |
263 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29561699 |
gcgcttcctgtttgcattaac-tttgtattttctttcacacaggt |
29561656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University