View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7469_high_16 (Length: 235)
Name: NF7469_high_16
Description: NF7469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7469_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 32036599 - 32036826
Alignment:
| Q |
1 |
cttgtgtgcacttttctagataggttgctctatcctttgtgcccataaatatagggctcttatgtaggcattctagatagcaccttttagtaaacgtttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32036599 |
cttgtgtgcacttttctagataggttgctctatcctttgtgcccataaatatagggctctcatgtaggcattctagatagcaccttttagtaaacgtttt |
32036698 |
T |
 |
| Q |
101 |
ctttttctttcataattcatnnnnnnnnnnnnnnnnnnnngtaattgaattatgatctagaagtctcgttatttcggtattcagttcggtttttaaaaga |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32036699 |
ctttttctttcataattcataaaaaaaaaaataataa----taattgaattatgatctagaagtctcgttatttcggtattcagttcggtttttaaaaga |
32036794 |
T |
 |
| Q |
201 |
gtaaacaattattttagacctaaatttgtgag |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32036795 |
gtaaacaattattttagacctaaatttgtgag |
32036826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University