View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7469_low_18 (Length: 248)
Name: NF7469_low_18
Description: NF7469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7469_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 32 - 242
Target Start/End: Complemental strand, 17106546 - 17106336
Alignment:
| Q |
32 |
catccatctacaatagcatcaaattcataaaatcaagtgaacaaagcacaaagattatcctagaaattcggcttaggaactctagtgaaatttgagcaaa |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17106546 |
catccatctacaatagcatcaaattcataaaatcaagtgaacaaagcacatagattatcctagaaattcggctttggaactctagtgaaatttgagcaaa |
17106447 |
T |
 |
| Q |
132 |
cgaagcccacaaggaatgtaatgatcaatacaacgatttttgaataaaagattgtgaaattcgaagtagtagaagtacctcaagcacagacgaagaactt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17106446 |
cgaagcccacaaggaatgtaatgatcaatacaacgttttttgaataaaagattgtgaatttcaaagtagtagaagtacctgaagcacagacgaagaactt |
17106347 |
T |
 |
| Q |
232 |
aagaacacgaa |
242 |
Q |
| |
|
||||||||||| |
|
|
| T |
17106346 |
aagaacacgaa |
17106336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University