View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7470_low_28 (Length: 265)

Name: NF7470_low_28
Description: NF7470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7470_low_28
NF7470_low_28
[»] chr7 (2 HSPs)
chr7 (1-130)||(37372175-37372304)
chr7 (148-265)||(37372290-37372408)


Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 37372175 - 37372304
Alignment:
1 atgagatggacatcactcaagaccgcaccaaaataatgttatgtacatacaaaacctataaattttgcattaaggaaataaatgagatggatggtagtca 100  Q
    |||| |||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||    
37372175 atgacatggacctcactcaagaccgcaccaaaataatgttatgtacatacaagacctataaattttgcattaaggaaataaatgagatggatggttgtca 37372274  T
101 aattaacagtggcaagtggagatttaggaa 130  Q
    |||||  |||||||||||||||||||||||    
37372275 aattactagtggcaagtggagatttaggaa 37372304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 148 - 265
Target Start/End: Original strand, 37372290 - 37372408
Alignment:
148 gtggagatttaggaaaactacaagagaaaatattataaaa-ttttagagattgatgagttcgagaatgatgtgatatatgacataatattatagtgtcat 246  Q
    ||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||    
37372290 gtggagatttaggaaaactacaagagaaattattataaaagttttagagattgatgagttcgagagtgatgtgatatatgacataatattatagtgttat 37372389  T
247 ttgattcatgtaaccaatc 265  Q
    |||||||||||||||||||    
37372390 ttgattcatgtaaccaatc 37372408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University