View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7471_high_11 (Length: 211)
Name: NF7471_high_11
Description: NF7471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7471_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 2247537 - 2247399
Alignment:
| Q |
14 |
ttggtggtctttctaatagcaggtctattagcctaattgagatttttaatgttaaataagctttcaagcttagttacaacttnnnnnnnctattatgtca |
113 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
2247537 |
ttggtgatctttctaatagcaggtctattagcctaattgagatttttaatgttaaataagctttcaagcttagttagaacttaaaaaaactattatgtca |
2247438 |
T |
 |
| Q |
114 |
taccttgaatgatagtttatgacaagtaatagattcata |
152 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2247437 |
taccttgaatgatagtttatgacaggtaatagattcata |
2247399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University