View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7471_high_9 (Length: 234)
Name: NF7471_high_9
Description: NF7471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7471_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 5897838 - 5898042
Alignment:
| Q |
19 |
gcatatataagcacttgttgaaaaggaacaaaattcacaatctaacttggtaatggtgccnnnnnnncctgaaaatctctcattggcatggaattcatgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5897838 |
gcatatataagcacttgttgaaaaggaacaaatttcacaatctaacttggtaatggtgcctttttt-cctgaaaatctctcattggcatggaattcatgc |
5897936 |
T |
 |
| Q |
119 |
ttcattaattctatatatgaggcagccacgttatatggataagtacaatttagttcttttccttgattcttgatcagcaactgaacacgtatagttctct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5897937 |
ttcattaattctatatatgaggcagccacgttatatggatgagtacaatttagttcttttccttgattcttgatcagcaactgaacacgtatagttctct |
5898036 |
T |
 |
| Q |
219 |
gcttct |
224 |
Q |
| |
|
||||| |
|
|
| T |
5898037 |
tcttct |
5898042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University