View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7471_low_13 (Length: 211)

Name: NF7471_low_13
Description: NF7471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7471_low_13
NF7471_low_13
[»] chr5 (1 HSPs)
chr5 (14-152)||(2247399-2247537)


Alignment Details
Target: chr5 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 2247537 - 2247399
Alignment:
14 ttggtggtctttctaatagcaggtctattagcctaattgagatttttaatgttaaataagctttcaagcttagttacaacttnnnnnnnctattatgtca 113  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||       |||||||||||    
2247537 ttggtgatctttctaatagcaggtctattagcctaattgagatttttaatgttaaataagctttcaagcttagttagaacttaaaaaaactattatgtca 2247438  T
114 taccttgaatgatagtttatgacaagtaatagattcata 152  Q
    |||||||||||||||||||||||| ||||||||||||||    
2247437 taccttgaatgatagtttatgacaggtaatagattcata 2247399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University