View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7471_low_5 (Length: 372)
Name: NF7471_low_5
Description: NF7471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7471_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 316
Target Start/End: Original strand, 2159995 - 2160295
Alignment:
| Q |
18 |
aaaaggacttagattcaaccattagaatcacttgttcttcgattcttatgcttgtaatgctagatagattagagcagctttaagtaaatattgattgaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2159995 |
aaaaggacttagattcaaccattagaatcacttgttcttcgattcttatgcttgtaatgctaga----ttagagcagctttaagtaaatattgattgaag |
2160090 |
T |
 |
| Q |
118 |
acccgtgttctcaaactctacgttaactgcccaactcactcgagtttctgtttttaaatgtgaatttagtgttaccttggtggtaaacta------nnnn |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2160091 |
acccgtgttctcaaactctacgttaactgcccaactcactcgagtttatgtttttaaatgtgaatttagtgttaccttggtggtaaactatttttttttt |
2160190 |
T |
 |
| Q |
212 |
nnnngtgaaatcagagtttgcatcgagtttgagcaagatttcacttggtgaaatgggataaacttgttcgattttcagtgagtttgcgattttactttta |
311 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2160191 |
ttttgtgaaatcggagtttgcatcgagtttgagcgagatttcactcggtgaaatgggataaacttgttcgattttcagtgagtttgcgattttactttta |
2160290 |
T |
 |
| Q |
312 |
aaaac |
316 |
Q |
| |
|
||||| |
|
|
| T |
2160291 |
aaaac |
2160295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 315
Target Start/End: Complemental strand, 43402981 - 43402934
Alignment:
| Q |
268 |
gataaacttgttcgattttcagtgagtttgcgattttacttttaaaaa |
315 |
Q |
| |
|
|||||||| |||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
43402981 |
gataaactcgttcgattttaagtgagtttgcgtttttacttttaaaaa |
43402934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University