View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7471_low_7 (Length: 252)
Name: NF7471_low_7
Description: NF7471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7471_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 13 - 236
Target Start/End: Original strand, 43726093 - 43726316
Alignment:
| Q |
13 |
aatatggttgtgacattgactgtttatttttcaatgaattttagattattttttaatgtttcttatagaaactggatattgccacatagattaacaccga |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43726093 |
aatacggttgtgacattgactgtttatttttcaatgaactttagattattttttaatgtttcttatagaaactggatattgccacatagattaacaccga |
43726192 |
T |
 |
| Q |
113 |
cccaaaattcaaaccaagaagaaaacccaaaatagttattgttaaccatttcttcaagtttactcttaggaaagcacaatcttggtggggaaatggaaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43726193 |
cccaaaattcaaaccaagaagaaaacccaaaatagttattgttaaccatttcttcaagtttactcttaggaaagcacaatcttggtggggaaatggaaaa |
43726292 |
T |
 |
| Q |
213 |
cgattcttcaccatccattaattg |
236 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43726293 |
cgattcttcaccatccattaattg |
43726316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University