View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7471_low_8 (Length: 250)
Name: NF7471_low_8
Description: NF7471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7471_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 134 - 237
Target Start/End: Complemental strand, 30019254 - 30019157
Alignment:
| Q |
134 |
tctacaggagattttccctttgaggagtttggtgaatcatttacattcacagttgcagcagctgcagcagtattaacctcattagcttttctttgttctt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| | ||||||||||||||||||||| |
|
|
| T |
30019254 |
tctacaggagattttccctttgaggagtttggtgaatcatttacattcacagttgcagcagcagctgcag------cagcattagcttttctttgttctt |
30019161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 39 - 78
Target Start/End: Complemental strand, 30019349 - 30019310
Alignment:
| Q |
39 |
catctgaagctggtccagcttcaacattattattattatc |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30019349 |
catctgaagctggtccagcttcaacattattattattatc |
30019310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University