View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7472_high_10 (Length: 315)
Name: NF7472_high_10
Description: NF7472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7472_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 15 - 300
Target Start/End: Original strand, 5568203 - 5568486
Alignment:
| Q |
15 |
aacaatggcaaattttattgtaagatggaaagttgatcttaatagttctagttagtctcttgtatttcagatcatctctgtaattatggttgttagtgat |
114 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5568203 |
aacaatggcaaattttattgtaagatg-aaagttgatcttaatagttctagttagtctcttgtatttcagatcatctctgtaattatggttgttagtgat |
5568301 |
T |
|
| Q |
115 |
ctctatctctaccagactaccatcgttactgcggccaaaagatcgatttcaatgtgcaatggaaccattgtaatccttatttagaggggattcttttcaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5568302 |
ctctatctctaccagactaccatcgttactgcggccaaaagatcgatttcaatgtgcaatggaaccattgtaatccttatttagaggggattcttttcaa |
5568401 |
T |
|
| Q |
215 |
gtttaaggtggttcagcaataaattttagagaaaaggtgagtctgatattgttttcaagggaatacttaaaagttggaaaattgat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5568402 |
gtttaaggtggttcagcaataaattttagagaaaaggtgagtctgatattgttttcaagggaatactt-aaagttggaaaattgat |
5568486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University