View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7472_high_13 (Length: 274)
Name: NF7472_high_13
Description: NF7472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7472_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 265
Target Start/End: Original strand, 6282727 - 6282975
Alignment:
| Q |
19 |
attactagacacttttttcttttcaagtgataatctttatgaacgtaagcnnnnnnnnn--ctatcccttttagccgtggaatcacatgcaaggctcggg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6282727 |
attactagacacttttttcttttcaagtgataatctttatgaacgtaagctttttttttttctatcccttttagccgtggaatcacatgcaaggctcggg |
6282826 |
T |
 |
| Q |
117 |
gtgatgccatatatccataaagtttgctagccaaagtgaaaagcttcaacacaagtgttgcttactcgccttttcccgatcaacagtgaactcaaaatta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6282827 |
gtgatgccatatatccataaagtttgctagccaaagtgaaaagcttcaacacaagtgttgcttactcgccttttcccgatcaacagtgaactcaaaatta |
6282926 |
T |
 |
| Q |
217 |
catgctagctgttcaacacctaaacatatttatcttcacatcatctctg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6282927 |
catgctagctgttcaacacctaaacatatttatctgcacatcatctctg |
6282975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University