View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7472_high_15 (Length: 257)
Name: NF7472_high_15
Description: NF7472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7472_high_15 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 13 - 257
Target Start/End: Original strand, 42685093 - 42685341
Alignment:
| Q |
13 |
aatatccaataagatagttgcccttgcgtcggttgctgtttttatcaacggaa-----gcaaatcttttattctagttgaatgattttaaattagttgac |
107 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42685093 |
aatatccaataagatagttgcccttaggtcggttgctgtttttatcaacggaattgaagtaaattttttattctagttgaatgattttaa-ttagttgac |
42685191 |
T |
|
| Q |
108 |
catgtagtgagtccgttggagagagtgagtaggtggcagcgagtcagggatttgactctttcatttcacttccatcaaattctcaacaaacttccaaata |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42685192 |
catgtagtgagtccgttggagagagtgagtaggtggcagcgagtcagggatttgactctttcatttcacttccatcaaattctcaacaaacttccaaata |
42685291 |
T |
|
| Q |
208 |
tcacttcataatagagtttcctaaaaaattggaatttctaaatggtgaaa |
257 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42685292 |
tcactccataatagagtttcctaaaaaattggaatttctaaatggtgaaa |
42685341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University