View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7472_low_12 (Length: 340)
Name: NF7472_low_12
Description: NF7472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7472_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 320
Target Start/End: Original strand, 34066615 - 34066934
Alignment:
| Q |
1 |
aaccaaacagtttgttacttcaaaataccaccagaaaatggcatcactaccctaaaacaacctcctagctgtagagtagttttcttgctcatccaattag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34066615 |
aaccaaacagtttgttacttcaaaataccaccagaaaatggcatctctaccctaaaacaacctcctagctgtagagtagttttcttgctcatccaattag |
34066714 |
T |
 |
| Q |
101 |
gaagataactaattgtcctaatttcatcgaacctgacttttggcaggttggggaatttaagagaaatgtattcatttcctaacaactaattcaaccacat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34066715 |
gaagataactaattgtcctaatttcatcgaacctgacttttggcaggttggggaatttaagagaaatgtattcatttcctaacaactaattctaccacat |
34066814 |
T |
 |
| Q |
201 |
gcaagcttttggatggaagaacatcatagaaaatgcagggttagaacatacaataaacatcaaatttaacacttcaggttcataaaatagggcaaaatta |
300 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34066815 |
gcaaacttttggatggaagaacatcatagaaaatgcagggttagaacatacaataaacatcaaatttaacacttcaggttcataaaatagggcaaaatta |
34066914 |
T |
 |
| Q |
301 |
ctgtctactaccttgatctg |
320 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
34066915 |
ctgtctagtaccttgatctg |
34066934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University