View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7472_low_22 (Length: 242)
Name: NF7472_low_22
Description: NF7472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7472_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 42685348 - 42685460
Alignment:
| Q |
1 |
aacttgtttggctctcgtgatctcatgttctataattgcatttttccttcaatcttaacatataccaattggtatcataggtgctttctttcaaaattgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42685348 |
aacttgtttggctctcgtgatctcatgttctataattgcatttttccttcaatcttaacatataccaattggtatcataggtgctttctttcaaaattgg |
42685447 |
T |
 |
| Q |
101 |
aattacctatcct |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42685448 |
aattacctatcct |
42685460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 154 - 223
Target Start/End: Original strand, 42685501 - 42685570
Alignment:
| Q |
154 |
gttttcttctttcttgacatcaatctttcgtctcctaagttacatttcaccagcattcaaactacccaac |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42685501 |
gttttcttctttcttgacatcaatctttcgtctcctaagttacatttcaccagcattcaaactagccaac |
42685570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University