View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7472_low_25 (Length: 210)
Name: NF7472_low_25
Description: NF7472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7472_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 28443155 - 28442981
Alignment:
| Q |
15 |
gaatatctgagcatacacactcggctcacaactacttggagttgaatgattcccagcgcaacagaaaaactgcaaattaaaagcagcacaaggaccctga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28443155 |
gaatatctgagcatacacactcggctcacaagtacttggagttgaatgattcccagcacaacagaaaaactgcaaattaaaagcagcacaaggaccctga |
28443056 |
T |
 |
| Q |
115 |
cacgccacaaccgtcccattttgtgttactttcaactctgttggacacaccgcattcaaatccgtaggacaaccc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28443055 |
cacgccacaaccgtcccattttgtgttactttcaactctgttggacacaccgcattcaaatccgtaggacaaccc |
28442981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 28484167 - 28483993
Alignment:
| Q |
15 |
gaatatctgagcatacacactcggctcacaactacttggagttgaatgattcccagcgcaacagaaaaactgcaaattaaaagcagcacaaggaccctga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28484167 |
gaatatctgagcatacacactcggctcacaagtatttggagttgaatgattcccaacacaacagaaaaactgcaaattaaaagcagcacaaggaccatga |
28484068 |
T |
 |
| Q |
115 |
cacgccacaaccgtcccattttgtgttactttcaactctgttggacacaccgcattcaaatccgtaggacaaccc |
189 |
Q |
| |
|
||||||||||| |||||||| | |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28484067 |
cacgccacaactgtcccattgttcgttactttcaactctgttggacacaccgcattcaaatcggtaggacaaccc |
28483993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University