View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7473_low_3 (Length: 338)
Name: NF7473_low_3
Description: NF7473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7473_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 14 - 320
Target Start/End: Complemental strand, 41821420 - 41821114
Alignment:
| Q |
14 |
atatcatcaattacctccaagatacccttgttgtctgcaagaatggctgctcttctatcattagtaaacaggaaaaaagctgacataggatgctttggtt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41821420 |
atatcatcaattacctccaagatacccttgttgtctgcaagaatagctgctcttctatcattagtaaacaggaaaaaagctgacataggatgctttggtt |
41821321 |
T |
 |
| Q |
114 |
tcaatggatccttctctttcttgttcttcttgctctccttttctgcatcttgtttgaattgcataaactgttcaagcaattccatagcagtcttctgctt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41821320 |
tcaatggatccttctctttcttgttcttcttgctctccttttctgcatcttgtttgaattgcataaactgttcaagcaattccatagcagtcttctgctt |
41821221 |
T |
 |
| Q |
214 |
ctgttcctcttctaagagtttcattgcctcaatttcacgtttttcctttgtaattacttgcaaataagcctctttttcagcttggtatttctcctcataa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41821220 |
ctgttcctcttctaagagtttcattgcctcaatttcacgtttttcctttgtaattacttgcaaataagcctctttttcagcttggtatttctcctcataa |
41821121 |
T |
 |
| Q |
314 |
ggcttct |
320 |
Q |
| |
|
||||||| |
|
|
| T |
41821120 |
ggcttct |
41821114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University