View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7473_low_7 (Length: 244)
Name: NF7473_low_7
Description: NF7473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7473_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 15 - 234
Target Start/End: Complemental strand, 37293195 - 37292976
Alignment:
| Q |
15 |
ttggtggtagtgtaaacaatgagaactccccaagtaatgaagctcatagttcttatgttatgcaatcatctttactgtctgtgcaagaggaatcccaact |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37293195 |
ttggtggtagtgtaaacaatgagaactccccaagtaatgaagctcatagttcttatgttatgcaatcatctttactgtctgtgcaagaggaatcccaact |
37293096 |
T |
|
| Q |
115 |
tacttcagcagcaatctcacccgatgagatgtacaactttgtcttttcgcctgttgatgaagagatggtgggagacccttcttacttggttgctataatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37293095 |
tacttcagcagcaatctcacccgatgagatgtacaactttgtcttttcgcctgttgatgaagagatggtgggagacccttcttacttggttgctataatt |
37292996 |
T |
|
| Q |
215 |
attgagtttcttcacaggtt |
234 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
37292995 |
attgagtttcttcacaggtt |
37292976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 219
Target Start/End: Complemental strand, 48306585 - 48306535
Alignment:
| Q |
168 |
ttgatgaagagatggtgggagacccttcttacttggttgctataattattga |
219 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||| ||||||| |||| |
|
|
| T |
48306585 |
ttgatgaagagatggtgggaaacccttcttactt-gttgatataattgttga |
48306535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University